Pregunta

Addition of two DNA sequenc
Hi, I have a problem in DNA addition %%%%%%DNA addition P_ DNA1='ACAAGGGTTTAAACCCTTAC'; P_DNA2='TTTTGGGAAATGTGACAT...

más de 4 años hace | 1 respuesta | 0

Pregunta

Binary to DNA sequence conversion
Hi, i have a binary string which I want to convert into DNA sequence. A='010110101010101011100110011111'; [m n]=size(A); mn=m...

más de 4 años hace | 1 respuesta | 0

Pregunta

reverse indexing of a matrix in matlab
Hi I have the code and i want the inverse mapping that is to get back P P=[188 5 95 60;3 59 0 111;255 123 51 84 ]; Ma=[25 222 ...

más de 4 años hace | 1 respuesta | 0

Pregunta

how to extract last 3 bits from binary string and then concatenate
Hi, i have an array which is converted into binary string. I want to extract last three bits and then arrange in an array Y=[12...

más de 4 años hace | 1 respuesta | 0

Pregunta

Permutation according to table
Hi, I have two tables P=[188 5 95 60;3 59 0 111;255 123 51 84]; Ma=[25 222 80 6;100 1 190 97;73 33 254 184]; M_1=[]; for i=1...

más de 4 años hace | 1 respuesta | 0

Pregunta

how to get answer from tic tok command that stays on the screen
Hi, I m using tic toc commamand , but answer appears in commad window for nano sec, i think and then disappears. i have attached...

casi 5 años hace | 1 respuesta | 0

Pregunta

How to get result of cipher after every round using DES
Hello, I am using DES code downloaded from file exchane, I want the output after every round . How to do this. (https://www....

casi 5 años hace | 0 respuestas | 0