Respondida
Vectorizing a loop that calculates cosd on every element?
You don't need vectorization to avoid computing the cosine on every iteration through the lambda loop - just put the calculation...

casi 11 años hace | 0

| aceptada

Respondida
what is the difference between imshow(im) or imshow(im, [])
If the second argument is not a spatial referencing object, a colormap or a string, it specifies the display range. From the <ht...

casi 11 años hace | 1

Respondida
I need help arranging two vectors
[AreaSorted, idx] = sort(Area); LengthSorted = Length(idx); WidthSorted = Width(idx);

casi 11 años hace | 2

Respondida
changing time from decimal days to +- 0 from high water
Guessing a bit, because you don't tell us what |pf| and |tf| are, but assuming they are water height and time vectors, I suspect...

casi 11 años hace | 0

| aceptada

Respondida
tell me about the methods to display an image and to display a part of image
See doc imshow You can select part of an image using indexing, or if you have the Image Processing Toolboox, with |imcro...

casi 11 años hace | 0

Respondida
Percentile of a value based on array of data
% Test data historicalData = rand(1000, 1); exogenousVariable = 0.7; % Compute centile nless = sum(historicalDat...

casi 11 años hace | 2

| aceptada

Respondida
What is the restriction of using FFT ?
The points made apply to Fourier analysis in general, not specifically to the FFT, and amount to asking whether the model you ar...

casi 11 años hace | 1

| aceptada

Respondida
Please help, logical indexing of 3D matrices
One way, slightly fiddly but the simplest I can think of now: [rowsB, colsB] = find(B); C = zeros(size(B)); ind3 = 1;...

casi 11 años hace | 0

Respondida
Using ifft to Recover Cosine from Two Delta Impulses
There are a number of reasons for the differences: * You do not need to divide by |No| after either the forward or backward t...

casi 11 años hace | 1

| aceptada

Respondida
How to interpret Binary '0' and '1' as Decimal 0 and 1?
One way: cdec = c - '0';

casi 11 años hace | 1

| aceptada

Respondida
How can I read global variables?
The problem is not connected with your use of a global variable. I think there are two possibilities: * If you click in the f...

casi 11 años hace | 0

| aceptada

Respondida
Finding when data in a matrix exceeds a certain value
find(X > 0, 1)

casi 11 años hace | 0

Respondida
How to create large (multiline) text file in matlab?
Yes, see doc fprintf or look <http://uk.mathworks.com/help/matlab/ref/fprintf.html here>. Multiple lines are achieved us...

casi 11 años hace | 0

Respondida
Error using * Inner matrix dimensions must agree.
It's likely that this line y = x1k * x2k; should be y = x1k .* x2k; The * operator does matrix multiplication, b...

casi 11 años hace | 0

Respondida
what is the size of the matrix of an image.will it is different for color images.
See the documentation for the Image Processing Toolbox, for example <http://uk.mathworks.com/help/images/image-types-in-the-tool...

casi 11 años hace | 0

Respondida
function kmeans is not able to process uint8 what should i do?
Convert your date to double before passing it to kmeans. For example, if Xi is your uint8 data array, Xd = double(Xi); i...

casi 11 años hace | 0

Respondida
"load_image" function help.
I do not know why the author chose this particular image for his examples, but there is a discussion of it <http://en.wikipedia....

casi 11 años hace | 0

| aceptada

Respondida
watershed segmentation
Good questions, but it's not clear what the link to MATLAB is. Anyway, you could do worse than start with <http://en.wikipedia.o...

casi 11 años hace | 1

Respondida
interpolation data and FFT resolution
The frequency resolution is always 1/T, where T is the time from the start to the end of the time series. The resolution is inde...

casi 11 años hace | 4

| aceptada

Respondida
Why must a function in the methods block of a class have an input argument?
The method declaration needs to start function stiffnessk(obj) The argument it needs is the object for which it is being...

casi 11 años hace | 3

Respondida
CONVERT DNA SEQUENCE INTO COMPLEX NUMBER
values('ATCG') = [-1+1i 1-1i -1-1i 1+1i]; % mapping from characters to complex s = 'ATCGCGCGATATATCGCGCG'; % any sp...

casi 11 años hace | 0

Respondida
conv2() for gray images
I'm not sure why you are converting i3 to uint8 before passing it to imshow. Try imshow(i3, []); which automatically sca...

casi 11 años hace | 0

Respondida
Detcting irregular circles with different sizes
You could consider the Hough Transform. The best place to start is <http://uk.mathworks.com/help/images/ref/imfindcircles.html i...

casi 11 años hace | 0

Respondida
mapping numbers to another number
I don't see why switching case might be relevant to this problem. Put the numbers you want to map to into an array outpu...

casi 11 años hace | 2

Respondida
Repeat previous row if condition
% Parameters cycleLength = 4; % number of rows in a cycle indexMult = 10; % multiplier for index within cycle ...

casi 11 años hace | 0

| aceptada

Respondida
fft - Documentation Question - What is "L"?
It's the number of data points in the synthesised signal vector. It didn't come from anywhere - the person writing the documenta...

casi 11 años hace | 0

| aceptada

Respondida
How to go to a main function from sub-function if sub-function is recursive? "return" does not work here
If the recursive function is structured properly, returning from the final call when the termination condition is satisfied will...

casi 11 años hace | 1

Respondida
Hough Transform - Finding the center of the hough transform circles
If it helps at all, <http://uk.mathworks.com/matlabcentral/fileexchange/26978-hough-transform-for-circles my version> of the FEX...

casi 11 años hace | 0

Respondida
Combining cells so items occur randomly or pseudorandomly within a new array
% test data expitemorder = { 'Strong_Alt_Prime2.png' 'Strong_Alt_Target2.png' 'Strong_Alt_Prime1.png' ...

casi 11 años hace | 0

Respondida
starting indexing of an array at values greater than 1
All MATLAB arrays are indexed from 1, but an alternative to Stephen Cobeldick's answer is to make an array Ashifted such that t...

casi 11 años hace | 0