Esta página aún no se ha traducido para esta versión. Puede ver la versión más reciente de esta página en inglés.

randsample

Descripción

ejemplo

y = randsample(n,k) devuelve valores muestreados uniformemente al azar, sin reemplazo, de los enteros a.k1n

ejemplo

y = randsample(population,k) Devuelve un vector de valores muestreados uniformemente al azar, sin sustitución, a partir de los valores del vector.kpopulation

ejemplo

y = randsample(___,replacement) Devuelve una muestra tomada con reemplazo si es, o sin reemplazo si es.replacementtruereplacementfalse Especifique después de cualquiera de las combinaciones de argumentos de entrada en las sintaxis anteriores.replacement

y = randsample(n,k,true,w) utiliza un vector de pesos no negativos, cuya longitud es, para determinar la probabilidad de que se seleccione un entero como entrada para.wniy

ejemplo

y = randsample(population,k,true,w) utiliza un vector de pesos no negativos, de la misma longitud que el vector, para determinar la probabilidad de que se seleccione un valor como entrada para.wpopulationpopulation(i)y

ejemplo

y = randsample(s,___) utiliza la secuencia para la generación aleatoria de números.s La opción puede preceder a cualquiera de los argumentos de entrada de las sintaxis anteriores. es un miembro de la clase.ssRandStream

Ejemplos

contraer todo

Dibuje un único valor de los enteros a través de.110

n = 10; x = randsample(n,1)
x = 9 

Cree la semilla aleatoria para la reproducibilidad de los resultados.

s = RandStream('mlfg6331_64'); 

Dibuje un valor único del vector.[10:20]

population = 10:20; y = randsample(s,population,1)
y = 17 

Cree el flujo de números aleatorios para reproducibilidad.

s = RandStream('mlfg6331_64');

Elija 48 caracteres aleatoriamente y con el reemplazo de la secuencia, de acuerdo con las probabilidades especificadas.ACGT

R = randsample(s,'ACGT',48,true,[0.15 0.35 0.35 0.15])
R =  'GGCGGCGCAAGGCGCCGGACCTGGCTGCACGCCGTTCCCTGCTACTCG' 

Cree el flujo de números aleatorios para reproducibilidad.

s = RandStream('mlfg6331_64'); 

Dibuje cinco valores con el reemplazo de los enteros.1:10

y = randsample(s,10,5,true)
y = 5×1

     7
     8
     5
     7
     8

Argumentos de entrada

contraer todo

Límite superior del rango (a) desde el que se muestra, especificado como un entero positivo.1n Por defecto, muestras uniformemente al azar, sin reemplazo, de los valores en el rango a.randsample1n

Tipos de datos: single | double

Datos de entrada de los que se muestra, especificado como un vector. Por defecto, muestras uniformemente al azar, sin reemplazo, de los valores en.randsamplepopulation La orientación de (fila o columna) es la misma que la de.ypopulation

Si es un vector numérico que solo contiene valores enteros no negativos y puede tener la longitud 1, utilice en lugar de.populationpopulationy = population(randsample(length(population),k))y = randsample(population,k)

Ejemplo: Devuelve un vector de valores muestreados uniformemente al azar, sin reemplazo, del vector que consta de enteros desde a.y = randsample([50:100],20)20population50100

Tipos de datos: single | double | logical | char | string | categorical

Número de muestras, especificadas como un entero positivo.

Ejemplo: Devuelve un vector de valores muestreados uniformemente al azar, sin reemplazo, de los enteros a.randsample(20,10)10120

Tipos de datos: single | double

Indicador de muestreo con sustitución, especificado como cualquiera o.falsetrue

Ejemplo: Devuelve dos valores con el reemplazo de los enteros a.randsample(10,2,true)110

Tipos de datos: logical

Ponderaciones de muestreo, especificadas como un vector de valores escalares no negativos. La longitud de debe ser igual al rango de enteros a la muestra o la longitud de.wpopulation El vector debe tener al menos un valor positivo.w Si contiene valores o valores negativos, muestra un mensaje de error.wNaNrandsample Las muestras de función con probabilidad proporcional a.randsamplew(i)/sum(w) Usualmente, es un vector de probabilidades.w La función admite la especificación de pesos sólo para muestreo con sustitución.randsample

Ejemplo: [0.1 0.5 0.35 0.46]

Tipos de datos: single | double

Secuencia numérica aleatoria, especificada como el flujo de números aleatorios predeterminado o.MATLABRandStream Para obtener más información, consulte.Crear y controlar un flujo de números aleatorios (MATLAB)

Ejemplo: crea un flujo de números aleatorios que utiliza el algoritmo multiplicativo del generador de Fibonacci retrasado.s = RandStream('mlfg6331_64')

Argumentos de salida

contraer todo

Sample, devuelta como un vector o escalar.

  • Si, entonces es un escalar.k = 1y

  • Si, entonces es un vector de-por-1.k > 1yk

Sugerencias

Para muestrear datos aleatoriamente, con o sin reemplazo, utilice.datasample

Capacidades ampliadas

Consulte también

| | |

Introducido antes de R2006a