Main Content

Esta página aún no se ha traducido para esta versión. Puede ver la versión más reciente de esta página en inglés.

randsample

Descripción

ejemplo

y = randsample(n,k) devuelve valores muestreados uniformemente al azar, sin reemplazo, desde los enteros hasta .k1n

ejemplo

y = randsample(population,k) devuelve un vector de valores muestreados uniformemente al azar, sin reemplazo, a partir de los valores del vector.kpopulation

ejemplo

y = randsample(___,replacement) devuelve una muestra tomada con reemplazo si es , o sin reemplazo si es .replacementtruereplacementfalse Especifique a continuación cualquiera de las combinaciones de argumentos de entrada en las sintaxis anteriores.replacement

y = randsample(n,k,true,w) utiliza un vector de ponderaciones no negativas, cuya longitud es , para determinar la probabilidad de que se seleccione un entero como entrada para .wniy

ejemplo

y = randsample(population,k,true,w) utiliza un vector de ponderaciones no negativas, , de la misma longitud que el vector, para determinar la probabilidad de que se seleccione un valor como entrada para .wpopulationpopulation(i)y

ejemplo

y = randsample(s,___) utiliza la secuencia para la generación de números aleatorios.s La opción puede preceder a cualquiera de los argumentos de entrada de las sintaxis anteriores. es miembro de la clase.ssRandStream

Ejemplos

contraer todo

Dibuje un único valor de los enteros a través de .110

n = 10; x = randsample(n,1)
x = 9 

Cree la semilla aleatoria para la reproducibilidad de los resultados.

s = RandStream('mlfg6331_64'); 

Dibuje un solo valor del vector .[10:20]

population = 10:20; y = randsample(s,population,1)
y = 17 

Cree la secuencia de números aleatorios para la reproducibilidad.

s = RandStream('mlfg6331_64');

Elija 48 caracteres aleatoriamente y con reemplazo de la secuencia, de acuerdo con las probabilidades especificadas.ACGT

R = randsample(s,'ACGT',48,true,[0.15 0.35 0.35 0.15])
R =  'GGCGGCGCAAGGCGCCGGACCTGGCTGCACGCCGTTCCCTGCTACTCG' 

Cree la secuencia de números aleatorios para la reproducibilidad.

s = RandStream('mlfg6331_64'); 

Dibuje cinco valores con el reemplazo de los enteros .1:10

y = randsample(s,10,5,true)
y = 5×1

     7
     8
     5
     7
     8

Argumentos de entrada

contraer todo

Límite superior del intervalo ( to ) desde el que se va a muestrear, especificado como un entero positivo.1n De forma predeterminada, muestras uniformemente al azar, sin reemplazo, desde los valores del rango hasta .randsample1n

Tipos de datos: single | double

Datos de entrada desde los que se muestrea, especificados como vector. De forma predeterminada, muestras uniformemente al azar, sin reemplazo, a partir de los valores de .randsamplepopulation La orientación de (fila o columna) es la misma que la de .ypopulation

Si es un vector numérico que contiene solo valores enteros no negativos, y puede tener la longitud 1, a continuación, utilice en lugar de .populationpopulationy = population(randsample(length(population),k))y = randsample(population,k)

Ejemplo: devuelve un vector de valores muestreados uniformemente al azar, sin reemplazo, del vector que consta de enteros de a .y = randsample([50:100],20)20population50100

Tipos de datos: single | double | logical | char | string | categorical

Número de muestras, especificado como un entero positivo.

Ejemplo: devuelve un vector de valores muestreados uniformemente al azar, sin reemplazo, de los enteros a .randsample(20,10)10120

Tipos de datos: single | double

Indicador de muestreo con sustitución, especificado como o .falsetrue

Ejemplo: devuelve dos valores con reemplazo de los enteros a .randsample(10,2,true)110

Tipos de datos: logical

Ponderaciones de muestreo, especificadas como un vector de valores escalares no negativos. La longitud de debe ser igual al intervalo de enteros que se van a muestrear o a la longitud de .wpopulation El vector debe tener al menos un valor positivo.w Si contiene valores o valores negativos, muestra un mensaje de error.wNaNrandsample La función muestra con una probabilidad proporcional a .randsamplew(i)/sum(w) Por lo general, es un vector de probabilidades.w La función admite la especificación de ponderaciones solo para el muestreo con sustitución.randsample

Ejemplo: [0.1 0.5 0.35 0.46]

Tipos de datos: single | double

Secuencia de números aleatorios, especificada como la secuencia de números aleatorios predeterminada o .MATLABRandStream Para obtener más información, consulte .Crear y controlar una secuencia de números aleatorios

Ejemplo: crea una secuencia de números aleatorios que utiliza el algoritmo de generador de Fibonacci retrasado multiplicativo.s = RandStream('mlfg6331_64')

Argumentos de salida

contraer todo

Muestra, devuelta como vector o escalar.

  • Si , entonces es un escalar.k = 1y

  • Si , entonces es un vector -by-1.k > 1yk

Sugerencias

Para muestrear datos aleatoriamente, con o sin reemplazo, utilice .datasample

Capacidades ampliadas

Consulte también

| | |

Introducido antes de R2006a