generate all variations on a 20-mer, that are 1 to 4 mismatches away
3 visualizaciones (últimos 30 días)
Mostrar comentarios más antiguos
Shlomo Geva
el 23 de Mayo de 2023
Editada: Shlomo Geva
el 22 de Jun. de 2023
We consider a kmer. An arbitray k long DNA sequence, consisting of only {A,C,G,T}.
For instance, 'ACTGGTCATTTGGGCTGGTA'. Let's call it a kernel.
We need to generate from the kernel an array of all unique kmers, each of which differs from the kernel by 1 to n positions.
n is typically a small number - 5 at most.
I wrote a solution, but it is a bit slow - it takes about 1.7 sec to generate all variations on a 20-mer, that are at most 4 mismatches away.
A much faster Matlab solution will be very useful, without going into the rabbit hole of implementing a MEX file.
Thanks!
2 comentarios
Walter Roberson
el 23 de Mayo de 2023
I wrote a solution, but it is a bit slow - it takes about 1.7 sec to generate all variations on a 20-mer, that are at most 4 mismatches away.
And how many seconds of your life are you prepared to dedicate to making the function faster? What is the estimated total number of times you expect your code will be executed before your program falls out of use?
Respuesta aceptada
Matt J
el 23 de Mayo de 2023
Editada: Matt J
el 23 de Mayo de 2023
Using blkColon from this FEX download,
kmer='ACTGGTCATTTGGGCTGGTA';
k=length(kmer);
n=4;
tic;
v=nchoosek(1:k,n);
clear c
[c{1:n}]=ndgrid('AGCT');
c=reshape( cat(n+1,c{:}),[],n);
p=height(c);
idx=repmat( any( (1:k)==permute(v,[2,3,1]) ,1) ,p,1,1);
Kmers=repmat( kmer ,p,1,height(v));
Kmers(idx)=repmat( c,1,1,size(idx,3));
Kmers=blkColon(Kmers,[1,k]);
Kmers(all(kmer==Kmers,2),:)=[]; %the result
toc;
Elapsed time is 0.164970 seconds.
3 comentarios
Más respuestas (0)
Ver también
Categorías
Más información sobre Electrophysiology en Help Center y File Exchange.
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!