Window length Selection size for DNA sequence?
    3 visualizaciones (últimos 30 días)
  
       Mostrar comentarios más antiguos
    
i have a DNA sequence like 
ATTCGATTGCCCAATTGGCTTATCCAATACTGGGA and wanna read the DNA sequcnce on a window size 5 ,10 and 15 so how to do this?? please drop a code 
0 comentarios
Respuestas (0)
Ver también
Categorías
				Más información sobre Genomics and Next Generation Sequencing en Help Center y File Exchange.
			
	Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!
