DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show comments
Loading...
Problem Recent Solvers5
Suggested Problems
-
Convert Roman to Arabic Numerals
125 Solvers
-
Back to basics 23 - Triangular matrix
1152 Solvers
-
Top of the Hour : Return from your routine within 1 second of the hour
26 Solvers
-
Getting the indices from a matrix
740 Solvers
-
Lychrel Number Test (Inspired by Project Euler Problem 55)
119 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!
