DNA Sequence Assembly - MATLAB Cody - MATLAB Central

Problem 47513. DNA Sequence Assembly

Difficulty:Rate
DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .

Solution Stats

20.0% Correct | 80.0% Incorrect
Last Solution submitted on Nov 18, 2020

Solution Comments

Show comments
Registration Now Open for MathWorks AUTOMOTIVE CONFERENCE 2025
...
Hello Community, We're excited to announce that registration is now open for the...

Problem Recent Solvers3

Suggested Problems

More from this Author2

Problem Tags

dna

Community Treasure Hunt

Find the treasures in MATLAB Central and discover how the community can help you!

Start Hunting!
Go to top of page