Problem 47513. DNA Sequence Assembly
DNA fragments are made by DNA sequencer.
To find full sequence, we need to concatenate each other using common sequence information.
So, when Input sequences are
(1) ATCGATCGAAGTCATCGGGAAA
(3) GGAAAGATCGATTACTTCCGAAA
(2) CCGAAAACCTAAGGGTTCTCAATGAC .
Output sequence is
'ATCGATCGAAGTCATCGGGAAAGATCGATTACTTCCGAAAACCTAAGGGTTCTCAATGAC' .
Solution Stats
Solution Comments
Show commentsProblem Recent Solvers3
Suggested Problems
-
16131 Solvers
-
282 Solvers
-
Back to basics 8 - Matrix Diagonals
960 Solvers
-
Find the elements of a matrix according to a defined property.
91 Solvers
-
Penny Flipping: Reverse subsets of a sequence of coins until you recover the original configuration
17 Solvers
More from this Author2
Problem Tags
Community Treasure Hunt
Find the treasures in MATLAB Central and discover how the community can help you!
Start Hunting!