Community Profile


lilly lord

Last seen: alrededor de 2 meses ago Active since 2020


  • Thankful Level 3
  • First Review

View badges

Content Feed

View by


Multiple lines to write using fid open
I have a matrix and some operation is performed on the rows e.g average of each row. I want to store those rows whose average is...

3 meses ago | 1 answer | 0




Nested for loop for multipication
Hello I am trying to multiply columns of Matrix E with numbers 1 till 5. Columns are taken one by one named as G. When I multipl...

3 meses ago | 1 answer | 0




How to write disjoint cycles in matlab?
a and b are from S-16 permutation written as disjoint cycle a=(1 3 5 7 9 11) b=(2 4 6 8 10 12 14) . %disjoint cycles a=(1 3 ...

4 meses ago | 0 answers | 0




How to calculate permutation powers
I have to find higher powers of a permutation. For example if M is a given permutation , then to calculate M^11 M= [ 1 2 ...

4 meses ago | 2 answers | 0




How to write cyclic permutation as an array in matlab?
I have disjoint permutation cycles such as (1 4 6 2 5 7 8 3)(9 10) means 1 comes under 4th position, 4 will be at 6th position...

4 meses ago | 1 answer | 0




How to write Multiple data in a single .txt files
Hi I want to write two different outputs in a single .txt file . for example The following code works well . I want to add one...

6 meses ago | 0 answers | 0




How to map Boolean functions
hi I have elements from 0 to 15 in binary form named as tab1, f is the boolean function s=[0,1,2,3,4,5,6,7,8,9,..15] %% binary ...

7 meses ago | 1 answer | 0




Error in Chaotic attracter
Hi I am trying to plot the following equations t_n = c - 6/(1+x_n ^2 + y_n^2); w_n+1 =1+u*(w_n*cos(t_n)-s_n*sin(t_n)); s_n+...

9 meses ago | 0 answers | 0




Error in fprint command
Hi. here is part of my code. i am getting error in f print command. The code and error message is also attached. If any one can ...

10 meses ago | 1 answer | 0




Matlab Function returns values
Hi. I have written a function which should return two sequences but it returns only single sequence. I have attached the code be...

10 meses ago | 1 answer | 0




Permutation based on array indices
Hi. I want to permute elemnts of a row matrix w.rt to anothe matrix of the same dimension. Below is the part of the code but it ...

10 meses ago | 1 answer | 0




Array element containing infinity
Hi. I have a problem in array indexing containing infinity. I have to compute the function f(a)=1-1/a mod 13 . It takes values ...

alrededor de 1 año ago | 0 answers | 0




How to permute binary numbers to a specific permutation
Hi I have numbers in binary form. I want to permute to 1 digit to right so that a new binary value is created. 0 F=[0 6 2 5 4...

alrededor de 1 año ago | 1 answer | 0




Row and Column permutation of a matrix
Hi I want to permute each row and column of the matrix using specified permutation e.g %%%%%Permute each row by a certain perm...

alrededor de 1 año ago | 1 answer | 0




Error in If else statement
Hi I am getting error in if else statement but dont know where is the mistake. Points=[]; for i=1:257 if i == 16 & i =...

alrededor de 1 año ago | 1 answer | 0




Generating matrix from another array
I am tring to generate a matrix S1,S2,S3 from an array E3 . All three matrices should contain numbers from 0 to 25 but in the ...

alrededor de 1 año ago | 1 answer | 0




How to multiply one elements with rest of the elements in Galois field
Hi, I am working in Galois field, The generated field is GF( 2^4) p=2; n=4; poly=[1 1 0 0 1]; field1=gftuple([-1:p^n-2]',pol...

alrededor de 1 año ago | 0 answers | 0




Bit xor of row with the next row and the output is again xored with the next row
Hi, I have a image and I want to xor first row with single number then Xor 2nd row with first, the output is xored aith the next...

más de 1 año ago | 1 answer | 0




Bit xor of two binary strings and conversion into decimal
Hi, I have two large binary strings (e.g 256 bits each), then how to perform bit Xor operation and then convert the answer into...

más de 1 año ago | 2 answers | 0




Dna encoding rule1
Hi I have an issue storing the DNA sequenc using for loop. If some one can help me. x=[2 34 50 21]; [m n]=size(x); mn=m*n; P...

más de 1 año ago | 0 answers | 0




Addition of two DNA sequenc
Hi, I have a problem in DNA addition %%%%%%DNA addition P_ DNA1='ACAAGGGTTTAAACCCTTAC'; P_DNA2='TTTTGGGAAATGTGACAT...

más de 1 año ago | 1 answer | 0




Binary to DNA sequence conversion
Hi, i have a binary string which I want to convert into DNA sequence. A='010110101010101011100110011111'; [m n]=size(A); mn=m...

más de 1 año ago | 1 answer | 0




reverse indexing of a matrix in matlab
Hi I have the code and i want the inverse mapping that is to get back P P=[188 5 95 60;3 59 0 111;255 123 51 84 ]; Ma=[25 222 ...

más de 1 año ago | 1 answer | 0




how to extract last 3 bits from binary string and then concatenate
Hi, i have an array which is converted into binary string. I want to extract last three bits and then arrange in an array Y=[12...

más de 1 año ago | 1 answer | 0




Permutation according to table
Hi, I have two tables P=[188 5 95 60;3 59 0 111;255 123 51 84]; Ma=[25 222 80 6;100 1 190 97;73 33 254 184]; M_1=[]; for i=1...

más de 1 año ago | 1 answer | 0




how to get answer from tic tok command that stays on the screen
Hi, I m using tic toc commamand , but answer appears in commad window for nano sec, i think and then disappears. i have attached...

más de 1 año ago | 1 answer | 0




How to get result of cipher after every round using DES
Hello, I am using DES code downloaded from file exchane, I want the output after every round . How to do this. (https://www....

más de 1 año ago | 0 answers | 0

